Online Inquiry
Adam9 cDNA ORF Clone, Mouse, untagged
SPD-00364
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse a disintegrin and metallopeptidase domain 9 (meltrin gamma). |
Target Information | |
---|---|
Species | Mouse |
Target Name | ADAM9 |
Gene Abbr. | Adam9 |
Gene ID | 11502 |
Full Name | a disintegrin and metallopeptidase domain 9 (meltrin gamma) |
Alias | AU020942, MDC9, Mlt, Mltng, mKIAA0021 |
Introduction | The ADAM (A Disintegrin and A Metalloprotease) family of multidomain membrane proteins influences cell signaling and adhesion by shedding cell surface proteins such as cytokines and growth factors, by influencing cell adhesion to the extracellular matrix (ECM), and by directly remodeling the ECM. Conserved domains in ADAM family members include a prodomain, a zinc-dependent metalloprotease domain, a disintegrin domain, a cysteine-rich domain, an EGF-like sequence, and a short cytoplasmic tail.The prodomain is thought to aid in protein folding. Disintegrin and cysteine-rich domains mediate adhesion, at least in part, through binding to integrins. Phosphorylation of the cytoplasmic tail as well as its interaction with other signaling proteins may influence intra- and extracellular signaling. ADAM9 is widely distributed and has been shown to affect migration in skin keratinocytes. Research studies have shown that ADAM9 is overexpressed in prostate cancer pancreatic cancer gastric cancer and has been linked to invasion and metastasis in small cell lung cancer. Research has also shown that an alternatively spliced short (50 kDa) form of ADAM9 containing protease activity is involved in tumor cell invasion. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse a disintegrin and metallopeptidase domain 9 (meltrin gamma). |
NCBI Ref Seq | NM_007404.2 |
RefSeq ORF Size | 2538 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.