Adam17 cDNA ORF Clone, Rat, C-Myc tag - CD BioSciences

service-banner

Adam17 cDNA ORF Clone, Rat, C-Myc tag

Adam17 cDNA ORF Clone, Rat, C-Myc tag

SPD-14386

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat ADAM metallopeptidase domain 17 with C terminal Myc tag.
Target Information
Species Rat
Target Name TACE
Gene Abbr. Adam17
Gene ID 57027
Full Name ADAM metallopeptidase domain 17
Alias TACE
Introduction TACE (TNF-α converting enzyme), also known as ADAM17, is a transmembrane metalloprotease that plays a key role in the cleavage of a number cell surface molecules in a process known as “shedding". TACE is abundantly expressed in many adult tissues, but in fetal development expression is differentially regulated. An important substrate of TACE is pro-TNF-α. Increased expression of TACE is associated with several pathological conditions including osteoarthritis and rheumatoid arthritis, where the pro-inflammatory effects of increased TNF-α contribute to disease pathogenesis. Regulation of other important molecules by TACE such as EGFR and Notch has recently been documented. TACE is responsible for the shedding of EGFR ligands such as amphiregulin and TNF-α. Some tumors have hyperactivated EGFR due to upregulated TNF-α production and upregulated TACE, making TACE a potential target for drug development. TACE activates Notch in a ligand-independent manner and has been shown to play a role in the development of the Drosophila nervous system. TACE has also been proposed to act as α-secretase for amyloid precursor protein (APP) and to be involved in the renewal and proliferation of neural stem cells.
Product Details
Description Full length Clone DNA of Rat ADAM metallopeptidase domain 17 with C terminal Myc tag.
NCBI Ref Seq NM_020306.1
RefSeq ORF Size 2484 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.