Online Inquiry
ADAM17 cDNA ORF Clone, Human, N-FLAG tag
SPD-14397
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human ADAM metallopeptidase domain 17 |
Target Information | |
---|---|
Species | Human |
Target Name | TACE |
Gene Abbr. | ADAM17 |
Gene ID | 6868 |
Full Name | ADAM metallopeptidase domain 17 |
Alias | ADAM18, CD156B, CSVP, NISBD, NISBD1 |
Introduction | TACE (TNF-α converting enzyme), also known as ADAM17, is a transmembrane metalloprotease that plays a key role in the cleavage of a number cell surface molecules in a process known as “shedding". TACE is abundantly expressed in many adult tissues, but in fetal development expression is differentially regulated. An important substrate of TACE is pro-TNF-α. Increased expression of TACE is associated with several pathological conditions including osteoarthritis and rheumatoid arthritis, where the pro-inflammatory effects of increased TNF-α contribute to disease pathogenesis. Regulation of other important molecules by TACE such as EGFR and Notch has recently been documented. TACE is responsible for the shedding of EGFR ligands such as amphiregulin and TNF-α. Some tumors have hyperactivated EGFR due to upregulated TNF-α production and upregulated TACE, making TACE a potential target for drug development. TACE activates Notch in a ligand-independent manner and has been shown to play a role in the development of the Drosophila nervous system. TACE has also been proposed to act as α-secretase for amyloid precursor protein (APP) and to be involved in the renewal and proliferation of neural stem cells. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human ADAM metallopeptidase domain 17 |
NCBI Ref Seq | BC062687 |
RefSeq ORF Size | 666 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 0.67kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.