Online Inquiry
Actb cDNA ORF Clone, Mouse, N-HA tag
SPD-00293
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse actin, beta with N terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Actin |
Gene Abbr. | Actb |
Gene ID | 11461 |
Full Name | actin, beta |
Alias | Act, Actx, E430023M04Rik, beta-a, beta-actin |
Introduction | Actin, a ubiquitous eukaryotic protein, is the major component of the cytoskeleton. At least six isoforms are known in mammals. Nonmuscle β- and γ-actin, also known as cytoplasmic actin, are ubiquitously expressed, controlling cell structure and motility. While all actin isoforms are highly homologous, cytoplasmic β- and γ-actin protein sequences differ by only four biochemically similar amino acids. For this reason, antibodies raised to β-actin may cross-react with γ-actin, and vice versa. α-cardiac and α-skeletal actin are expressed in striated cardiac and skeletal muscles, respectively; two smooth muscle actins, α- and γ-actin, are found primarily in vascular smooth muscle and enteric smooth muscle, respectively. These actin isoforms regulate the contractile potential of muscle cells. Actin exists mainly as a fibrous polymer, F-actin. In response to cytoskeletal reorganizing signals during processes such as cytokinesis, endocytosis, or stress, cofilin promotes fragmentation and depolymerization of F-actin, resulting in an increase in the monomeric globular form, G-actin. The ARP2/3 complex stabilizes F-actin fragments and promotes formation of new actin filaments. Research studies have shown that actin is hyperphosphorylated in primary breast tumors. Cleavage of actin under apoptotic conditions has been observed in vitro and in cardiac and skeletal muscle, as shown in research studies. Actin cleavage by caspase-3 may accelerate ubiquitin/proteasome-dependent muscle proteolysis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse actin, beta with N terminal HA tag. |
NCBI Ref Seq | NM_007393.5 |
RefSeq ORF Size | 1170 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | HindIII + NotI (6kb + 1.17kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.