ACTB cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

ACTB cDNA ORF Clone, Human, C-HA tag

ACTB cDNA ORF Clone, Human, C-HA tag

SPD-00299

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human actin, beta with C terminal HA tag.
Target Information
Species Human
Target Name Actin
Gene Abbr. ACTB
Gene ID 60
Full Name actin beta
Alias BRWS1, PS1TP5BP1
Introduction Actin, a ubiquitous eukaryotic protein, is the major component of the cytoskeleton. At least six isoforms are known in mammals. Nonmuscle β- and γ-actin, also known as cytoplasmic actin, are ubiquitously expressed, controlling cell structure and motility. While all actin isoforms are highly homologous, cytoplasmic β- and γ-actin protein sequences differ by only four biochemically similar amino acids. For this reason, antibodies raised to β-actin may cross-react with γ-actin, and vice versa. α-cardiac and α-skeletal actin are expressed in striated cardiac and skeletal muscles, respectively; two smooth muscle actins, α- and γ-actin, are found primarily in vascular smooth muscle and enteric smooth muscle, respectively. These actin isoforms regulate the contractile potential of muscle cells. Actin exists mainly as a fibrous polymer, F-actin. In response to cytoskeletal reorganizing signals during processes such as cytokinesis, endocytosis, or stress, cofilin promotes fragmentation and depolymerization of F-actin, resulting in an increase in the monomeric globular form, G-actin. The ARP2/3 complex stabilizes F-actin fragments and promotes formation of new actin filaments. Research studies have shown that actin is hyperphosphorylated in primary breast tumors. Cleavage of actin under apoptotic conditions has been observed in vitro and in cardiac and skeletal muscle, as shown in research studies. Actin cleavage by caspase-3 may accelerate ubiquitin/proteasome-dependent muscle proteolysis.
Product Details
Description Full length Clone DNA of Human actin, beta with C terminal HA tag.
NCBI Ref Seq NM_001101.3
RefSeq ORF Size 1128 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.