Online Inquiry
ACSS2 Knockout Cell Line
SPL-00072
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 113bp deletion |
| Target Information | |
|---|---|
| Target Name | ACSS2 |
| Gene Abbr. | ACSS2 |
| Gene ID | 55902 |
| Full Name | acyl-CoA synthetase short chain family member 2 |
| Alias | ACAS2, ACECS, ACS, ACSA, AceCS1 |
| Species | Human |
| Genomic Locus | chr20:34913456 |
| Transcript | NM_018677 |
| WT Expression Level | 18.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 113bp deletion in a coding exon of ACSS2. |
| Description | 113bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCTGGCATGTGCCCGCATT |
| PCR Primer |
Forward: GCAAGGGATGGAAAGAATTTGGTAA Reverse: ATTTAAGACCCTCCATCATCTAGGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.