ACHE Knockout Cell Line - CD BioSciences

service-banner

ACHE Knockout Cell Line

ACHE Knockout Cell Line

SPL-00064

Size Price
1 Unit Online Inquiry
Description
26bp deletion
Target Information
Target Name ACHE
Gene Abbr. ACHE
Gene ID 43
Full Name acetylcholinesterase (Cartwright blood group)
Alias ACEE, ARACHE, N-ACHE, YT
Species Human
Genomic Locus chr7:100894063
Transcript NM_000665
WT Expression Level 1.63 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of ACHE.
Description 26bp deletion
Parental Cell Line C631
Guide RNA Sequence ATTCGCCTGAAGACCCCCGG
PCR Primer Forward: ATATTGGTAGCAGACACTCTGGAAG
Reverse: GTTCCCTGCATTTGTCTGGATATG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.

We use cookies to understand how you use our site and to improve the overall user experience. This includes personalizing content and advertising. Read our Privacy Policy

Accept Cookies
x