ABL2 Knockout Cell Line - CD BioSciences

service-banner

ABL2 Knockout Cell Line

ABL2 Knockout Cell Line

SPL-00043

Size Price
1 Unit Online Inquiry
Description
31bp deletion
Target Information
Target Name c-Abl
Gene Abbr. ABL2
Gene ID 27
Full Name ABL proto-oncogene 2, non-receptor tyrosine kinase
Alias ABLL, ARG
Species Human
Genomic Locus chr1:179126604
Transcript NM_001168239
WT Expression Level 5.27 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of ABL2.
Description 31bp deletion
Parental Cell Line C631
Guide RNA Sequence AGTTCGCTCTAAGAATGGGC
PCR Primer Forward: ATCTGCAGTGGTATTGATCCTGTAG
Reverse: CTAGGTGAAAAGCTACGAGTCCTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.