ABL1 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

ABL1 cDNA ORF Clone, Human, N-HA tag

ABL1 cDNA ORF Clone, Human, N-HA tag

SPD-01918

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human c-abl oncogene 1, receptor tyrosine kinase with N terminal HA tag.
Target Information
Species Human
Target Name c-Abl
Gene Abbr. ABL1
Gene ID 25
Full Name ABL proto-oncogene 1, non-receptor tyrosine kinase
Alias ABL, BCR-ABL, CHDSKM, JTK7, bcr/abl
Introduction The c-Abl proto-oncogene encodes a nonreceptor protein tyrosine kinase that is ubiquitously expressed and highly conserved in metazoan evolution. c-Abl protein is distributed in both the nucleus and the cytoplasm of cells. It is implicated in regulating cell proliferation, differentiation, apoptosis, cell adhesion, and stress responses. c-Abl kinase activity is increased in vivo by diverse physiological stimuli including integrin activation; PDGF stimulation; and binding to c-Jun, Nck, and RFX1. The in vivo mechanism for regulation of c-Abl kinase activity is not completely understood. Tyr245 is located in the linker region between the SH2 and catalytic domains. This positioning is conserved among Abl family members. Phosphorylation at Tyr245 is involved in the activation of c-Abl kinase. In addition, phosphorylation at Tyr412, which is located in the kinase activation loop of c-Abl, is required for kinase activity.
Product Details
Description Full length Clone DNA of Human c-abl oncogene 1, receptor tyrosine kinase with N terminal HA tag.
NCBI Ref Seq BC117451.1
RefSeq ORF Size 3492 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1554A/G,3381A/G not causing the amino acid variation.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI (two restriction sites) + XbaI (6kb + 0.48kb + 3.01kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.