Online Inquiry
ABL1 cDNA ORF Clone, Human, N-FLAG tag
SPD-01915
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human c-abl oncogene 1, receptor tyrosine kinase with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | c-Abl |
Gene Abbr. | ABL1 |
Gene ID | 25 |
Full Name | ABL proto-oncogene 1, non-receptor tyrosine kinase |
Alias | ABL, BCR-ABL, CHDSKM, JTK7, bcr/abl |
Introduction | The c-Abl proto-oncogene encodes a nonreceptor protein tyrosine kinase that is ubiquitously expressed and highly conserved in metazoan evolution. c-Abl protein is distributed in both the nucleus and the cytoplasm of cells. It is implicated in regulating cell proliferation, differentiation, apoptosis, cell adhesion, and stress responses. c-Abl kinase activity is increased in vivo by diverse physiological stimuli including integrin activation; PDGF stimulation; and binding to c-Jun, Nck, and RFX1. The in vivo mechanism for regulation of c-Abl kinase activity is not completely understood. Tyr245 is located in the linker region between the SH2 and catalytic domains. This positioning is conserved among Abl family members. Phosphorylation at Tyr245 is involved in the activation of c-Abl kinase. In addition, phosphorylation at Tyr412, which is located in the kinase activation loop of c-Abl, is required for kinase activity. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human c-abl oncogene 1, receptor tyrosine kinase with N terminal Flag tag. |
NCBI Ref Seq | BC117451.1 |
RefSeq ORF Size | 3450 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 48G/A,51G/A,1593A/G,3420A/G not causing the amino acid variation. |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 3.02kb + 0.48kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.