ABCC1 Knockout Cell Line - CD BioSciences

service-banner

ABCC1 Knockout Cell Line

ABCC1 Knockout Cell Line

SPL-00031

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name ABCC1
Gene Abbr. ABCC1
Gene ID 4363
Full Name ATP binding cassette subfamily C member 1
Alias ABC29, ABCC, DFNA77, GS-X, MRP
Species Human
Genomic Locus chr16:16009786
Transcript NM_004996
WT Expression Level 27.37 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra-and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a multispecific organic anion transporter, with oxidized glutatione, cysteinyl leukotrienes, and activated aflatoxin B1 as substrates. This protein also transports glucuronides and sulfate conjugates of steroid hormones and bile salts. Alternatively spliced variants of this gene have been described but their full-length nature is unknown. [provided by RefSeq, Apr 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of ABCC1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TTTTGCTGTGGATCGTCTGC
PCR Primer Forward: CATACCGAGGACTTGTCCTTATTCC
Reverse: TATTACTTTTGGTCTCCACTGAGCC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.