Online Inquiry
ABCC1 Knockout Cell Line
SPL-00031
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp insertion |
Target Information | |
---|---|
Target Name | ABCC1 |
Gene Abbr. | ABCC1 |
Gene ID | 4363 |
Full Name | ATP binding cassette subfamily C member 1 |
Alias | ABC29, ABCC, DFNA77, GS-X, MRP |
Species | Human |
Genomic Locus | chr16:16009786 |
Transcript | NM_004996 |
WT Expression Level | 27.37 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra-and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a multispecific organic anion transporter, with oxidized glutatione, cysteinyl leukotrienes, and activated aflatoxin B1 as substrates. This protein also transports glucuronides and sulfate conjugates of steroid hormones and bile salts. Alternatively spliced variants of this gene have been described but their full-length nature is unknown. [provided by RefSeq, Apr 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of ABCC1. |
Description | 1bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTTTGCTGTGGATCGTCTGC |
PCR Primer |
Forward: CATACCGAGGACTTGTCCTTATTCC Reverse: TATTACTTTTGGTCTCCACTGAGCC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.