Online Inquiry
ABCA7 Knockout Cell Line
SPL-00029
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | ABCA7 |
| Gene Abbr. | ABCA7 |
| Gene ID | 10347 |
| Full Name | ATP binding cassette subfamily A member 7 |
| Alias | ABCA-SSN, ABCX, AD9 |
| Species | Human |
| Genomic Locus | chr19:1043450 |
| Transcript | NM_019112 |
| WT Expression Level | 11.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This full transporter has been detected predominantly in myelo-lymphatic tissues with the highest expression in peripheral leukocytes, thymus, spleen, and bone marrow. The function of this protein is not yet known; however, the expression pattern suggests a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of ABCA7. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCCATGAGCTTCCGGGTAAA |
| PCR Primer |
Forward: GTACGAGGCTAGTGACCTGATG Reverse: GAACTGTCGTTCATGAAGGTGAAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.